Novel homogeneous selective electrocatalysts for CO2 reduction: an electrochemical and computational study of cyclopentadienyl-phenylendiamino-cobalt complexes

Four cyclopentadienyl-phenylendiamino-cobalt complexes [CoCp(bqdi)] with different substituents (R) at the phenylene moiety (bqdi, I; o-perfluoro-bqdi, II; p-NO2-bqdi, III; p-COOH-bqdi, IV) have been studied with an aim to investigate their capability as catalysts for the CO2 reduction. These compounds were characterized by cyclic voltammetry measurements both under nitrogen and CO2 atmospheres, showing an increase in the cathodic current ranging from 3.36 (III) to 5.59 times (II) that of the measurement under nitrogen. Moreover, with the addition of water, the current enhancement in the presence of CO2 reaches 31.07 times that of the case of complex II. Interestingly, these complexes exhibit very good selectivity toward CO2 reduction irrespective of hydrogen even in the presence of water. The relative turnover frequencies were also estimated, given the values ranging from 3.23 (III) to 187.21 s−1 (II) in the presence of water. In addition, these results were analysed by means of density functional theory (DFT) calculations and Fukui functions analysis. In particular, DFT results clearly show effects of different substituents on the electrochemical properties of these compounds. Whereas, the Fukui functions analysis indicates that the most favourable positions for an electrophilic attack on the reduced complex are the nitrogen and cobalt atoms

Sulphur vs NH Group: Effects on the CO2 Electroreduction Capability of Phenylenediamine-Cp Cobalt Complexes

The cobalt complex (I) with cyclopentadienyl and 2-aminothiophenolate ligands was investigated as a homogeneous catalyst for electrochemical CO2 reduction. By comparing its behavior with an analogous complex with the phenylenediamine (II), the effect of sulfur atom as a substituent has been evaluated. As a result, a positive shift of the reduction potential and the reversibility of the corresponding redox process have been observed, also suggesting a higher stability of the compound with sulfur. Under anhydrous conditions, complex I showed a higher current enhancement in the presence of CO2 (9.41) in comparison with II (4.12). Moreover, the presence of only one -NH group in I explained the difference in the observed increases on the catalytic activity toward CO2 due to the presence of water, with current enhancements of 22.73 and 24.40 for I and II, respectively. DFT calculations confirmed the effect of sulfur on the lowering of the energy of the frontier orbitals of I, highlighted by electrochemical measurements. Furthermore, the condensed Fukui function f - values agreed very well with the current enhancement observed in the absence of water

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments

Non-Uniform FFT and Its Applications in Particle Simulations

Ewald summation method, based on Non-Uniform FFTs (ENUF) to compute the electrostatic interactions and forces, is implemented in two different particle simulation schemes to model molecular and soft matter, in classical all-atom Molecular Dynamics and in Dissipative Particle Dynamics for coarse-grained particles. The method combines the traditional Ewald method with a non-uniform fast Fourier transform library (NFFT), making it highly efficient. It scales linearly with the number of particles as , while being both robust and accurate. It conserves both energy and the momentum to float point accuracy. As demonstrated here, it is straight- forward to implement the method in existing computer simulation codes to treat the electrostatic interactions either between point-charges or charge distributions. It should be an attractive alternative to mesh-based Ewald methods

Molecular dynamics simulation study of parallel telomeric DNA quadruplexes at different ionic strengths: evaluation of water and ion models

Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Åqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel. We have performed a series of MD simulations of the human full-parallel telomeric quadruplex by neutralizing its negative charge with K+ ions. Three combinations of different cation potential parameters and water models have been used: (a) Åqvist ion parameters, TIP3P water model; (b) Joung and Cheatham ion parameters, TIP3P water model; and (c) Joung and Cheatham ion parameters, TIP4Pew water model. For the combinations (b) and (c), the effect of the ionic strength has been evaluated by adding increasing amounts of KCl salt (50, 100, and 200 mM). Two independent simulations using the Åqvist parameters with the TIP3P model show that this combination is clearly less suited for the studied quadruplex with K+ as counterions. In both simulations, one ion escapes from the channel, followed by significant deformation of the structure, leading to deviating conformation compared to that in the reference crystallographic data. For the other combinations of ion and water potentials, no tendency is observed for the channel ions to escape from the quadruplex channel. In addition, the internal mobility of the three loops, torsion angles, and counterion affinity have been investigated at varied salt concentrations. In summary, the selection of ion and water models is crucial as it can affect both the structure and dynamics as well as the interactions of the quadruplex with its counterions. The results obtained with the TIP4Pew model are found to be closest to the experimental data at all of the studied ion concentrations

Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of Spermidine3+ With DNA Double Helices

Polyamines have important roles in the modulation of the cellular function and are ubiquitous in cells. The polyamines putrescine2+, spermidine3+, and spermine4+ represent the most abundant organic counterions of the negatively charged DNA in the cellular nucleus. These polyamines are known to stabilize the DNA structure and, depending on their concentration and additional salt composition, to induce DNA aggregation, which is often referred to as condensation. However, the modes of interactions of these elongated polycations with DNA and how they promote condensation are still not clear. In the present work, atomistic molecular dynamics (MD) computer simulations of two DNA fragments surrounded by spermidine3+ (Spd3+) cations were performed to study the structuring of Spd3+ “caged” between DNA molecules. Microsecond time scale simulations, in which the parallel DNA fragments were constrained at three different separations, but allowed to rotate axially and move naturally, provided information on the conformations and relative orientations of surrounding Spm3+ cations as a function of DNA-DNA separation. Novel geometric criteria allowed for the classification of DNA-Spd3+ interaction modes, with special attention given to Spd3+ conformational changes in the space between the two DNA molecules (caged Spd3+). This work shows how changes in the accessible space, or confinement, around DNA affect DNA-Spd3+ interactions, information fundamental to understanding the interactions between DNA and its counterions in environments where DNA is compacted, e.g. in the cellular nucleus

Carbon Nanodots from an In Silico Perspective

Carbon nanodots (CNDs) are the latest and most shining rising stars among photoluminescent (PL) nanomaterials. These carbon-based surface-passivated nanostructures compete with other related PL materials, including traditional semiconductor quantum dots and organic dyes, with a long list of benefits and emerging applications. Advantages of CNDs include tunable inherent optical properties and high photostability, rich possibilities for surface functionalization and doping, dispersibility, low toxicity, and viable synthesis (top-down and bottom-up) from organic materials. CNDs can be applied to biomedicine including imaging and sensing, drug-delivery, photodynamic therapy, photocatalysis but also to energy harvesting in solar cells and as LEDs. More applications are reported continuously, making this already a research field of its own. Understanding of the properties of CNDs requires one to go to the levels of electrons, atoms, molecules, and nanostructures at different scales using modern molecular modeling and to correlate it tightly with experiments. This review highlights different in silico techniques and studies, from quantum chemistry to the mesoscale, with particular reference to carbon nanodots, carbonaceous nanoparticles whose structural and photophysical properties are not fully elucidated. The role of experimental investigation is also presented. Hereby, we hope to encourage the reader to investigate CNDs and to apply virtual chemistry to obtain further insights needed to customize these amazing systems for novel prospective applications

Selecting molecular or surface centers in carbon dots-silica hybrids to tune the optical emission: A photo-physics study down to the atomistic level

In this work, we unveil the fluorescence features of citric acid and urea-based Carbon Dots (CDs) through a photo-physical characterization of nanoparticles synthesized, under solvent-free and open-air condi-tions, within silica-ordered mesoporous silica, as a potential host for solid-state emitting hybrids. Compared to CDs synthesized without silica matrices and dispersed in water, silica-CD hybrids display a broader emission in the green range whose contribution can be increased by UV and blue laser irradi-ation. The analysis of hybrids synthesized within different silica (MCM-48 and SBA-15) calls for an active role of the matrix in directing the synthesis toward the formation of CDs with a larger content of graphitic N and imidic groups at the expense of N-pyridinic molecules. As a result, CDs tuned in size and with a larger green emission are obtained in the hybrids and are retained once extracted from the silica matrix and dispersed in water. The kinetics of the photo-physics under UV and blue irradiation of hybrid samples show a photo-assisted formation process leading to a further increase of the relative contribution of the green emission, not observed in the water-dispersed reference samples, suggesting that the porous matrix is involved also in the photo-activated process. Finally, we carried out DFT and TD-DFT calcula-tions on the interaction of silica with selected models of CD emitting centers, like surface functional groups (OH and COOH), dopants (graphitic N), and citric acid-based molecules. The combined experimen-tal and theoretical results clearly indicate the presence of molecular species and surface centers both emitting in the blue and green spectral range, whose relative contribution is tuned by the interaction with the surrounding media

In silico study of PEI-PEG-squalene-dsDNA polyplex formation: the delicate role of the PEG length in the binding of PEI to DNA

Using a two step simulation protocol the atomistic interactions between PEG and b-PEI and the effect of these interactions on DNA binding were determined